SIEP publications are protected by copyright and all rights are reserved.  SIEP publications may not be reproduced in any form or by any means without written permission from the copyright owner. This includes the posting of electronic files on the Internet, transferring electronic files to other persons, distributing printed output, and photocopying. Requests for authorization to make photocopies should be directed to:   SIEP, 1697 Lark Lane, Cherry Hill, NJ 08003-3157 Tel: (856) 429 2699, Fax:  (856) 429 7414, Email: barnea@earlypregnancy.org

EARLY PREGNANCY: Biology and Medicine Editor-in-Chief: Eytan R. Barnea MD, FACOG

January 2003
Volume VI, Number 1
ISSN: 1537-6583
Pages: 235-247 

First Trimester Human Trophoblast Production Of Placental Corticotrophin-Releasing Hormone (CRH) Is Unresponsive To Hypoxia In-Vitro

 Mei Yee Choy (*), Tse Ngong Leung (*), Po Sing Leung (**), Tse Kin Lau (*)

(*)Department of Obstetrics & Gynaecology, The Chinese University of Hong Kong, Hong Kong, SAR, (**) Department of Physiology, The Chinese University of Hong Kong, Hong Kong, SAR China

Short title: Early placental CRH production is unresponsive to hypoxia in-vitro

Corresponding author: Dr Mei Yee Choy, Department of Obstetrics & Gynaecology, The Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, Hong Kong, SAR China, Tel: (852) 26323099, Fax: (852) 26360008, Email: meiychoy@cuhk.edu.hk

Key Words: First trimester, human, CRH, hypoxia, in-vitro

Objectives
The biological role and regulation of human placental CRH remains an enigma. This is especially true for CRH production during early pregnancy, although more recently, there is evidence to suggest that CRH may play a role in implantation. Early placental development occurs under a relatively hypoxic environment. Many genes associated with placental development are regulated by hypoxia in vivo and in vitro. The objective of this study is therefore to investigate by using an in-vitro system, whether human first trimester trophoblast primary culture and placental explant production of CRH protein and mRNA is influenced by hypoxia.

 Methods
Day 2 human trophoblast primary cultures and explants were cultured under normoxia or hypoxia for 24 hr. Hypoxic cultures were generated using commercially available anaerobic bags. Purity of trophoblast primary cultures and localisation of placental villous CRH were determined by immunocytochemistry.  Both atmospheric and cellular hypoxia were verified. CRH secretion was measured using ELISA kits and CRH mRNA detected using RT-PCR.

 Results
Results show no difference of hypoxia on CRH mRNA expression or CRH secretion from primary cultures or from placental explants. Unexpectedly, in-vitro, first trimester trophoblast production of CRH peptide and mRNA expression is abundant.

Conclusion
Hypoxia does not directly influence human first trimester trophoblast production of CRH in-vitro. However, its strong presence in first trimester suggests that trophoblastic CRH at the fetal-maternal interface may be involved with important events of early pregnancy in the human.

Corticotrophin-releasing hormone (CRH) is classically known as a 41 amino-acid neuropeptide, which regulates the hypothalamic-pituitary axis by stimulating the release of adrenocorticotropin (ACTH) from the anterior pituitary in response to stress (Vale et al., 1981). Placental CRH has the same amino- acid sequence, biological and immunoreactivity as its hypothalamic counterpart (Shibahara et al., 1983; Sasaki et al., 1988) and is found in abundance at term (Shibasaki et al., 1982). Production is localized to trophoblastic cells (Riley et al., 1991; Perkins and Linton 1995), and preferentially secreted into the maternal circulation (Sasaki et al., 1984; Goland et al., 1986). However, its exact biological role and regulation in this transient tissue is unknown.

Diverse functions have been associated with placental CRH in successful pregnancy, including its role in the onset of parturition (McLean et al., 1995; Parker et al., 1999; Reis et al., 1999) and as an important vasodilator in the fetal-placental vasculature (Clifton et al., 1995; Donoghue et al., 2000). Moreover, CRH has recently been shown to be associated with the successful implantation of the blastocyst in humans (Makrigiannakis et al., 2001,). Clearly, it seems that, early gestation production of placental CRH is also important for the maintenance of successful pregnancies.

Early placental development and trophoblastic invasion occurs under a relatively hypoxic environment (Aplin, 2000) and many developmentally important genes in early pregnancy are responsive to changes in oxygen tension in vivo (Rajakumar and Conrad, 2000; Caniggia et al., 2000). To date, the regulatory effect of hypoxia on human placental CRH production is not known, although maternal plasma CRH is abnormally raised in pregnancies associated with placental hypoxia, such as pre-eclampsia (PE) and intra-uterine growth restriction (IUGR) (Wolfe et al., 1988; Laatikainen et al., 1991;Goland et al., 1993). The aim of this study is therefore to determine whether CRH production is influenced by hypoxia in first trimester single- cell trophoblast primary cultures and whole placental explants in vitro.

Human placentae from the product of legal termination of pregnancy were obtained with the approval of the Ethical Committee of The Chinese University of Hong Kong. Patient consent was also obtained prior to each collection.

Preparation of human first trimester trophoblast primary cultures
First trimester human trophoblast primary cultures were prepared and their purity assessed according to the method of Choy et al, [1998]. Trophoblast cells were prepared for either a) immunocytochemical analysis of cellular hypoxia and CRH expression using multi-well Lab-Tek chamber slides (Nalge Nunc International, USA), b) cultured in 24 -well tissue culture plates for CRH ELISA determination, c) cultured in 25cm³ flasks for RT-PCR determination. Hypoxic conditions commenced on day 2 trophoblastic cultures. For CRH ELISA determination, medium was changed on day 2 and replaced with 250m l/well.

Preparation of first trimester placental villous explant culture
First trimester placenta was collected in Ham’s F10 growth medium and transported back to the laboratory, washed in sterile PBS and dissected into approximately 5mm³ pieces. Explants were placed in 30mm tissue culture dishes (Nalge Nunc International, USA), and cultured in 2mls of Ham’s F10 (5% FCS) in a humidified atmosphere of 95% O₂, 5%CO_2. Medium was changed on day 2 of culture and incubated for 24hr in 250m l of fresh Ham’s F10 (5% FCS) under normoxic or hypoxic conditions as for trophoblast primary cultures.

Generation of hypoxic cultures
Hypoxic first trimester primary cultures and explants were prepared from day 2 cells and tissues. Day 2 primary cultures and placental explants were placed in Anaerocult^R anaerobic bags (Merck KgaA, Germany) according to manufacturer’s instructions. The system incorporates a reagent mixture that reacts with water to catalytically reduce O₂ to undetectable levels. An Anaerotest ^R test strip (Merck, KgaA, Germany) which detects oxygen by a chemical reduction of a colour dye was included in each experiment. To determine the accuracy and reliability of the bags, the oxygen content of one representative bag was monitored with an oxygen sensor, [GC 501, range 0-25%], (GC Industries, Inc, USA) for 4hr. All cultures were replaced with fresh Ham’s F10 (5% FCS) medium at the beginning of the hypoxic/normoxic experiment.

Chemical testing of cellular hypoxia
Hypoxic cell and explant cultures were tested for their ability to bind pimonidazol hydrochloride, using a Hypoxyprobe-1 kit (Natural Pharmacia International Inc, Belmont MA, USA). Pimonidazol binds only to cells that have oxygen concentrations less than 14 m M, which is equivalent to a pO₂ of 10mmHg at 37^oC. Pimonidazol hydrochloride (0.1mM) was added to D2 primary cultures cells before hypoxic treatment in anaerobic bags (24hr) and to controls. Binding of pimonidazol hydrochloride was detected with the accompany monoclonal antibody to protein adducts of Hypoxyprobe-1 in hypoxic cells.

i) Indirect immunoperoxidase
Microtome sections (5m m) of formalin- fixed, paraffin embedded, normoxic and hypoxic explant cultures were prepared for immunocytochemical analysis of CRH using the avidin/biotin indirect peroxidase method. Briefly, sections were de-paraffinised with 2 washes in xylene and rehydrated by sequential rinses in absolute, 95%, 80%, 70% ethanol. Endogenous peroxidase activity was exhausted by incubation with 1% H₂O₂ in distilled water for 30 min. Antigen retrieval was performed by placing sections in citrate buffer pH 6.0 and microwave heating for 3 min high and 5 min medium heat. Non -specific binding was sequentially blocked with 3% BSA in TBS for 30 min followed by an avidin/biotin block (Vector Laboratories, USA). Primary polyclonal rabbit anti-human CRH (1/₅₀)[Phoenix Pharmaceuticals, USA] was applied for 1 hr and secondary goat anti rabbit biotinylated antibody (1/₃₀₀) for 30 min. After incubation in secondary antibody, sections were washed in TBS and strepavidin peroxidase R.T.U (Vector Laboratories, USA) added for 15 min. Immunostaining was visualized using the DAB-Plus Reagent set kit (Zymed) and counterstained in Mayers haematoxylin and mounted in DPX.

ii) Indirect immunofluorescence
Production of CRH in first trimester trophoblast primary cultures were immunocytochemically analysed by immunofluorescence, using the avidin/biotin method. Briefly, normoxic and hypoxic slides were air-dried and acetone fixed for 15 min at 4^oC. Non-specific binding was blocked with a goat serum (1/ ₁₀₀) for 30 min, washed and further incubated with rabbit anti-human CRH (1/₅₀) (Phoenix Pharmaceuticals, Inc. Belmont, CA, USA) for 1 hr. After incubation, secondary antibody, biotinylated goat anti-rabbit (1/₃₀₀) was applied for 30 min and visualised with fluorescein- conjugated (FITC) strepavidin (1/₅₀). Sections were mounted in Vectorshield mounting medium (Vector Laboratories, Burlingame, USA]. Rabbit IgG were used as negative controls.

iii) Immunofluorescent detection of pimonidazol binding
Normoxic and hypoxic cell cultures and placental villi explants treated with Hypoxyprobe-1 were stained using the avidin/biotin immunofluorescence system. Briefly, primary culture slides and frozen placental sections were air-dried and fixed in acetone for 15 min at 4^oC. Slides were incubated with 1/₅₀ rabbit serum for 30 min and washed in PBS. Monoclonal primary antibody to hypoxic adducts was added according to the manufacturer’s instructions and incubated at room temperature for 1 hr. Primary antibody was washed off with PBS at the end of incubation and the secondary antibody, a biotinylated rabbit anti-mouse (1/₃₀₀) [Dako, A/S, USA] was added for 30 min. Slides were washed in PBS and further incubated with FITC-strepavidin (1/₅₀) [Dako, A/S, USA] for 15 min in the dark, washed and mounted in Vectorshield fluorescent mounting medium (Vector Laboratories, Inc, Burlingame, USA).

Determination of CRH secretion
Measurement of CRH secretion was determined using CRH Enzyme Immunoassay kits [EIA] (Phoenix Pharmaceuticals, Inc. Belmont, CA, USA), according to manufacturer’s instructions. Six matched preparations of both primary cultures and placental explants were analysed. Normoxic and hypoxic cell and explant supernatants were assayed in 50m l volumes. Three wells/culture dishes from each placental preparation were assayed, each being measured in triplicates. Manufacturer’s values for the intra-and inter-assay variability of the CRH kits are <5% and <14% respectively. Protein determination was made using the Bradford Protein Assay (Bio-Rad Laboratories, UK).

Reverse Transcription- Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted from normoxic and hypoxic trophoblast primary cultures and explants using the TRIZOL method (Life Technologies, UK), which is primarily based upon the acid guanidinium thiocyanate-phenol-chloroform method of Chomczynski and Sacchi, [1987]. Cells and explants were prepared according to manufacturer’s instructions. Briefly, cells and explants were homogenized in 0.5ml or more of TRIZOL, chloroform extracted and RNA precipitated by isopropanol. The resultant pellet was finally resuspended in water treated with diethylpyrocarbonate (DEPC). Total RNA was measured spectrophotometrically at 260nm. RNA (2m g from cells and 4m g from explants) were subjected to first strand cDNA synthesis using oligo-deoxytrinucleotides (dT) at a concentration of 0.5m g/m l and 200U of Superscript reverse transcriptase (RT) (Promega,) in a final volume of 20m l. The reaction mixture was first incubated at 70^oC for 10 min, cooled on ice for 5 min before further incubation for 1 hr at 42^oC.

Polymerase Chain Reaction (PCR)
The PCR reaction was performed using 0.8m l of cDNA in a total volume of 20m l comprising of 18.2m l of PCR buffer mix, 0.2m l (5U/m l) of Taq DNA polymerase (Sangon, Shanghai, The Republic of China), and 1m l of primers [(human CRH (10m M); human b - actin housekeeping gene (10m M)]. Oligonucleotide primers were designed and synthesized by Life Technologies, Hong Kong according to the following sequences: 1) hCRH, sense: CAACTTTTTCCGCGTGTTGCT, anti-sense: ATGGCATAAGAGCAGCGCTAT [product size=360bp]. 2) Human b -actin, sense AAGACCTGTACGCCAACACA, antisense AAGAAAGGGTGTAACGCAAC [product size =240bp].

A few drops of mineral oil were added to each reaction tube to prevent sample evaporation. The following PCR conditions were used: 40 cycles of denaturing at 94^oC, 1 min; annealing 60^oC, 1 min and elongation, 72^oC, 1 min. PCR products were separated by electrophoresis on a 2% agarose gel containing 0.01% ethidium bromide and visualised with a Flurochem image analyser. Identification of specific PCR products were made against a 100bp DNA molecular weight ladder (GeneRuler 100bp DNA ladder Plus MBI Fermentas).

Establishment of in-vitro hypoxia
In addition to using oxygen-sensitive test strips to verify the oxygen status of the anaerobic bags in each experiment, a representative bag was also tested for the generation of an anaerobic environment by monitoring its oxygen status for 4 hr using an oxygen monitor (range 0-25% O₂). Percentage oxygen dropped from 20.9% atmospheric to 1% after 1 hr, and remained stable for 4 hr.

Immunohistochemical localisation of piminadazol binding was detected in hypoxic primary cell cultures (figure 1a,b) and in hypoxic placental explants (figure 1d). Normoxic cells and explants did not bind to piminadazol (figure 1c and figure 1e).

Immunocytochemical analysis of CRH in first trimester trophoblast primary cultures and placental explants
Immunocytochemical analysis did not show any discernable difference in CRH expression between normoxic and hypoxic cultures in both cells and explants, hence, for simplicity, only normoxic samples are shown (figures 2a and 2b). CRH is strongly expressed in both the cyto and syncytiotrophoblastic layers in placental explants (figure 2b).

In-vitro secretion of CRH
Samples were randomly assayed and all readings fell within the linear range of the standard curve. Statistical analysis using t-test show no significant difference in CRH secretion between normoxic and hypoxic primary cultures [N=2.3± 1.9ng/mg protein; H= 2.1± 2.0ng/mg protein; p>0.05] and explant cultures [N=0.58± 0.67ng/mg protein; H=0.612± 0.63ng/mg protein; p>0.05] (figure 3).

RT-PCR analysis of CRH mRNA expression
CRH mRNA expression was optimal at 40 cycles of amplification and an annealing temperature of 60^oC. Both first trimester primary cultures (figure 4a) and first trimester placental explants (figure 4b) strongly expressed CRH mRNA, (360bp), but semi-quantitative analysis using b actin (240bp) showed no significant difference normoxic and hypoxic samples. The ratio of CRH mRNA of normoxic: hypoxic cells and explant cultures = 1.

We could not demonstrate any effect of hypoxia on CRH production in either first trimester primary cultures or in placental explants in vitro. We have been rigorous with our system of in-vitro hypoxia, having verified both the external environment by oxygen monitoring and the induction of cellular hypoxia using a chemical assay (pimonidazole binding). Pimonidazole becomes covalently bound to thiol-containing proteins in hypoxic cells and is used as a marker of tissue hypoxia in both animal and human studies (Kennedy et al., 1997). In our ex-vivo system, hypoxic trophoblastic single cells demonstrated intense cytoplasmic staining for pimonidazol hydrochloride (figure 1a,b), and hypoxic placental explants show strong staining in trophoblastic layers (figure 1e).

Hypoxia had no effect on CRH peptide secretion (figure 3) or CRH mRNA expression (figure 4). Interference from corticotrophin releasing hormone binding protein (CRHBP) in assaying for CRH in unextracted cultured supernatants is mostly likely to be minimal as CRHBP could not be detected in cultured trophoblasts by immunocytochemistry or by RT-PCR (data not shown). In addition, any effect of CRHBP would be reflected in both normoxic and hypoxic cultures.

The mechanism(s) by which CRH gene expression maintains homeostasis under hypoxic stress is an enigma. There is substantial evidence to suggest that placental physiology at the gene and protein level is altered under hypoxic conditions (Benyo et al., 1997; Seligman et al., 1997; Caniggia et al., 2000). Activation of CRH gene expression via ligand binding to CRH receptors is mediated via a cAMP regulatory element (CRE) present in the promoter region of the CRH gene (Cheng et al., 2000a; Cheng et al., 2000b). We do not know whether oxygen- sensitive transduction signal pathway(s) in human trophoblast involve stimulation of cAMP, and if so, the question remains as to what are the mechanisms able to keep in check CRE activation under non-receptor mediated stimulation of cAMP. Our findings show that, at least, in-vitro, first trimester trophoblast production of CRH is unresponsive to low-oxygen tension per se. To better demonstrate the negative effect of hypoxia on CRH gene expression, one could also include a known stimulator/ inhibitor of CRH gene expression.

Of significance however, is the fact that human first trimester trophoblasts produce CRH in abundance in culture. The literature is sparse on information regarding early human placental CRH production. The classical study by Frim et al., [1988], of gestational CRH production in human placenta, showed that levels of CRH mRNA using Northern blot analysis was barely detectable during first trimester and only reached significant levels at 29 weeks. Peptide production was also undetectable before 15 weeks. Petraglia et al., [1992], in their study of decidual CRH production during pregnancy also found that placental CRH mRNA was extremely low during first trimester, but rose significantly towards term. Okamoto et al., [1990] even reported the absence of CRH mRNA in first and second trimester placenta. The apparent discrepancy in first trimester CRH production between the above studies and ours is likely to be due to the higher sensitivity of detection with RT-PCR than Northern blot analysis.

We conclude that human trophoblastic CRH production during first trimester is resistant to hypoxic regulation in vitro. Its apparent abundant production under normoxic culture conditions together with its known involvement in early implantation events (Athanassakis et al., 1999; Makrigiannakis et al., 1995a; Makrigiannakis et al., 2001b) warrants further investigation to elucidate its biological role and significance in early pregnancy.

For personal use. Only reproduce with permission from SIEP.

Aplin, JD. (2000). Hypoxia and placental development. J. Clin. Invest. 105(5): 559-60

Athanassakis I, Farmakiotis V, Aifantis I, Gravanis A, Vassiliadis S. (1999). Expression of corticotrophin-releasing hormone in the mouse uterus: participation in embryo implantation. J Endocrinol. 163(2): 221-7

Benyo, DF., Miles, TM., Conrad, KP. (1997). Hypoxia stimulates cytokine production by villous explants from the human placenta. J. Clin. Endocrinol. Metab. 82;1582-1588

Caniggia, I., Winter, J., Lye, SJ., Post, M. (2000). Oxygen and placental development during the first trimester: implications for the pathophysiology of pre-eclampsia. Placenta; 21 suppl A; s25-30

Cheng, YH., Nicholson, RC., King, B., Chan, EC., Fitter, JT., Smith, R. (2000a).Glucocorticoid stimulation of corticotropin-releasing hormone gene expression requires a cyclic adenosine 3’, 5’-monophosphate regulatory element in human primary placental cytotrophoblast cells. J. Clin. Endocrinol. Metab. 85(5); 1937-45

Cheng, YH., Nicholson, RC., King, B., Chan, EC., Fitter, JT., Smith, R. (2000b).Corticotropin-releasing hormone gene expression in primary placental cells is modulated by cyclic adenosine 3’5’ monophosphate. J. Clin. Endocrinol. Metab. 85(3); 1239-44

Chomczynski, P and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analy. Biochem. 162: 1; 156-9

Choy, MY and Manyonda, IT. (1998). The phagocytic activity of human first trimester extravillous trophoblast. Hum. Repro. 13(10); 2941-2949

Clifton, VL., Read, MA., Leitch, IM., Giles, WB., Boura, AL., Robinson, PJ., Smith, R. (1995) Corticotropin-releasing hormone-induced vasodilatation in the human fetal-placental circulation: involvement of the nitric oxide-cyclic guanosine 3',5'-monophosphate-mediated pathway. J. Clin. Endocrinol. Metab., 80; 2888-2893

Donoghue, JF., Leitch, IM., Boura, ALA., Walters, WAW., Giles, WB., Smith, R., Read, MA. (2000). Fetal placental vascular responses to corticotropin-releasing hormone in vitro. Effects of variation in oxygen tension. Placenta 21; 711-717

Frim, DM., Emanuel, RL., Robinson, BG., Smas, CM., Adler, GK., Majzoub, JA. (1988). Characterization and gestational regulation of corticotropin-releasing hormone messenger RNA in human placenta. J. Clin. Invest. 82; 287-292

Goland, RS., Wardlaw, SL., Stark, RI., Brown, LS., Frantz, AG. (1986). High levels of corticotrophin-releasing hormone immunoactivity in maternal and fetal plasma during pregnancy. J Clin. Endocrinol. Metab. 63; 1199-1203

Goland, RS., Tropper, PJ., Warren, WB., Stark, RI., Jozak, SM., Conwell, IM. (1995). Concentrations of corticotrophin-releasing hormone in the umbilical-cord blood of pregnancies complicated by pre-eclampsia. Reprod. Fertil. Dev. 7; 1227-1230

Kennedy, AS., Raleigh, JA., Perex, GM., Calkine, DP., Thrall, DE., Novothy, DB., Varia, MA. (1997). Proliferation and hypoxia in human squamous cell carcinoma of the cervix: first report of combined immunohistochemical assays. Int. J. Radiat. Oncol. Biol. Phys. 37(4); 897-905

Laatikainen, T., Virtanen, T., Kaaji, R., (1991). Corticoptropin-releasing hormone in maternal and cord plasma in pre-eclampsia. Eur J Obstet Gynecol Reprod Biol. 39; 19-24

Makrigiannakis A^a, Margioris AN, Legoascogne C, Zoumakis E, Nikas G, Stournaras C, Psychoyos A, Gravanis A. (1995). Corticotropin-releasing hormone (CRH) is expressed at the implantation sites of early pregnant rat uterus. Life Sci. 57; 1869-1875

Makrigiannakis, A^b., Zoumakis, E., Kalantaridou, S., Coutifaris, C., Margioris, AN., Coukos, G., Rice, KC., Gravanis, A., Chrousos, GP. (2001). Corticotropin-releasing hormone promotes blastocyst implantation and early maternal tolerance. Nat Immunol. 2(11); 1018-24

McLean, M., Bisits, A., Davies, J., Woods, R., Lowry, P., Smith, R. (1995) A placental clock controlling the length of human pregnancy. Nature Med. 1; 460-463

Okamoto, E., Takagi, T., Azuma, C., Kimura, T., Tokugawa, Y., Mitsuda, N., Saji, F., Tanizawa, O., (1990). Expression of the corticotropin-releasing hormone (CRH) gene in human placenta and amniotic membrane. Horm. Metab. Res. 22; 394-397

Perkins, AV and Linton, EA. (1995) Identification and isolation of corticotrophin-releasing hormone positive cells from the human placenta. Placenta 16; 233-243

Parker, CR Jr., Stankovic, AM., Goland, RS. (1999). Corticotropin-releasing hormone stimulates steroidogenesis in cultured human adrenal cell. Mol. Cell. Endocrinol.155; (1-2); 19-25

Petraglia, F., Tabanelli, F., Galassi, MC., Garuti, GC., Mancini, AC., Genazzani, AR., Guroide, E. (1992). Human decidua and in vitro decidualised endometrial stromal cells at term contain immunoreactive corticotropin-releasing factor (CRF) and CRF messenger ribonucleic acid. J. Clin. Endocrinol. Metab. 74; 1427-1431

Rajakumar A and Conrad KP. (2000).Expression, ontogeny, and regulation of hypoxia-inducible transcription factors in the human placenta. Biol. Reprod. 63(2); 559-69

Reis, FM., Fadalti, M., Florio, P., Petraglia, F. (1999).Putative role of placental corticotropin-releasing factor in the mechanisms of human parturition. J. Soc. Gynecol. Investig.6(3);109-19

Riley, SC., Walton, JC., Herlick, JM., Challis, JR. (1991).The localization and distribution of corticotropin-releasing hormone in the human placenta and fetal membranes throughout gestation. J. Clin. Endocrinol. Metab. 72, 1001-7

Sasaki, A., Tempst, P., Liotta, AS., Margioris, AN., Hood, LE., Kent, SHB. (1988) Isolation and characterization of a corticotropin-releasing hormone –like peptide from human placenta. J. Clin. Endocrinol. Metab. 67(4); 768-773

Sasaki, A., Liotta, AS., Luckry, MM., Margioris, AN., Suda, T., Krieger, DT. (1984). Immunoreactive corticotropin-releasing factor is present in human maternal plasma during the third trimester of pregnancy. J. Clin. Endocrinol. Metab. 59; 812-4

Seligman, SP., Nishiwaki, T., Kadner, SS., Dancis, J., Finlay. TH. (1997).Hypoxia stimulates ecNOS mRNA expression by differentiated human trophoblasts. Ann. NY. Acad. Sci. 828;180-7

Shibasaki, T., Odagriri, E., Shizume, K., Ling, N. (1982). Corticotropin releasing factor-like activity in human placental extracts. J. Clin. Endocrinol. Metab. 82; 55:384

Vale, W., Speiss, J., Rivier, C. (1981). Characterisation of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science 213, 1394-7

Wolfe, CDA., Patel, SP., Linton, EA., Campbell, EA., Anderson J, Dornhorst A et al. (1988) Plasma corticotropin-releasing factor (CRF) in abnormal pregnancy. Br. J. Obstet. Gynecol. 95; 1003-1006

Figure 1

Determination of cellular hypoxia in trophoblast cultures: detection of pimonidazol hydrochloride binding

Immunofluorescent analysis of pimonidazole hydrochloride binding in trophoblast primary cultures and placental explants. Strong, prevalent, granular staining of pimonidazol (arrows) can be detected in hypoxic cells (figures 1a, 1b,) and in explants, positive staining reside mostly in the trophoblastic layer (figure 1d). There is no staining with normoxic cultures (figure 1c, 1e).

Magnification figures 1a, b = x100mag; figure 1c=  x40mag; figure 1d,e = x 40
Scale bars: figure 1a=10mM; figure 1b=3mM; figure 1c =20mM; figure 2d,e  = 20mM  

    1 A.                                                                                       1B.
                          

1C.

     1D.                                                                                       1E.
                   

Figure 2

Immunocytochemical determination of CRH in cultured first trimester trophoblast primary cultures and placental explants

Magnification: a = x 40mag; b= x 20mag. Scale bars: a = 40mM; b = 80mM

2.

Figure 3

Effect of hypoxia on CRH secretion in first trimester primary culture and explants

3.

Figure 4

RT-PCR analysis of CRH mRNA in normoxic and hypoxic first trimester and term trophoblasts

4A.

4B.